miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0002755

Accession MI0002755
ID ptr-mir-107
Description Pan troglodytes miR-107 stem-loop
Stem-loop 
c   c      --c    u  u           c   u   a 
 ucu ugcuuu   agcu cu uacaguguugc uug ggc u
 ||| ||||||   |||| || ||||||||||| ||| ||| g
 aga acgaaa   ucgg ga auguuacgacg aac uug g
-   c      cua    -  c           -   -   a
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (PanTro2.1) Overlapping transcripts
10: 89860535-89860615 [-]
sense
ENSPTRT00000024551 ; XM_507906.2; intron 4
ENSPTRT00000005175 ; XM_001143095.1; intron 5
ENSPTRT00000005176 ; XM_001143021.1; intron 5
ENSPTRT00000066572 ; XM_001142941.1; intron 6
Database links
Gene family

MIPF0000024; mir-103

Mature sequence MIMAT0002459

Accession MIMAT0002459
ID ptr-miR-107
Sequence

50 -  

agcagcauuguacagggcuauca

 - 72

Get sequence
Evidence by similarity; MI0000114
Predicted targets

References

1
"Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).