|
miRBase |
|
miRBase has moved to http://www.mirbase.org/ - please update your links.
Stem-loop sequence MI0002755 |
|||||
| Accession | MI0002755 | ||||
| ID | ptr-mir-107 | ||||
| Description | Pan troglodytes miR-107 stem-loop | ||||
| Stem-loop |
c c --c u u c u a ucu ugcuuu agcu cu uacaguguugc uug ggc u ||| |||||| |||| || ||||||||||| ||| ||| g aga acgaaa ucgg ga auguuacgacg aac uug g - c cua - c - - a |
||||
| Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
||||
| Genome context |
|
||||
| Database links |
|
||||
| Gene family |
MIPF0000024; mir-103 |
||||
Mature sequence MIMAT0002459 |
|
| Accession | MIMAT0002459 |
| ID | ptr-miR-107 |
| Sequence |
50 - agcagcauuguacagggcuauca - 72 |
| Evidence | by similarity; MI0000114 |
| Predicted targets |
|
References |
|
| 1 |
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|