Stem-loop sequence mml-mir-107

AccessionMI0002754 (change log)
DescriptionMacaca mulatta miR-107 stem-loop
Gene family MIPF0000024; mir-103
Literature search

1 open access papers mention mml-mir-107
(1 sentences)

Stem-loop
   c   c      --c    u  u           c   u   a 
5'  ucu ugcuuu   agcu cu uacaguguugc uug ggc u
    ||| ||||||   |||| || ||||||||||| ||| ||| g
3'  aga acgaaa   ucgg ga auguuacgacg aac uug g
   -   c      cua    -  c           -   -   a 
Get sequence
Deep sequencing
971820 reads, 6.18e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 84746619-84746699 [-]
sense
ENSMMUT00000009883 ; SGMS1-201; intron 6
Database links

Mature sequence mml-miR-107-5p

Accession MIMAT0026584
Sequence

13 - 

agcuucuuuacaguguugccuug

 - 35

Get sequence
Deep sequencing64 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-107-3p

Accession MIMAT0002458
Sequence

50 - 

agcagcauuguacagggcuauca

 - 72

Get sequence
Deep sequencing971755 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).