miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0002743

Accession MI0002743
ID mml-mir-103-1
Description Macaca mulatta miR-103-1 stem-loop
Stem-loop 
uac    c  --    u  u           c   u g a 
   ugcc uc  ggcu cu uacagugcugc uug u c u
   |||| ||  |||| || ||||||||||| ||| | |  
   acgg ag  ucgg ga auguuacgacg aac a g a
guu    a  ua    -  c           -   u g u
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 164939534-164939611 [-]
sense
Database links
Gene family

MIPF0000024; mir-103

Mature sequence MIMAT0002447

Accession MIMAT0002447
ID mml-miR-103
Sequence

48 -  

agcagcauuguacagggcuauga

 - 70

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
"Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
"Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).