miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0002742

Accession MI0002742
ID ptr-mir-103-1
Description Pan troglodytes miR-103-1 stem-loop
Stem-loop 
uac    c  --    u  u           c   u g a 
   ugcc uc  ggcu cu uacagugcugc uug u c u
   |||| ||  |||| || ||||||||||| ||| | |  
   acgg ag  ucgg ga auguuacgacg aac a g a
guu    a  ua    -  c           -   u g u
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (PanTro2.1) Overlapping transcripts
5: 170805656-170805733 [-]
sense
ENSPTRT00000032369 ; XM_518087.2; intron 5
Database links
Gene family

MIPF0000024; mir-103

Mature sequence MIMAT0002446

Accession MIMAT0002446
ID ptr-miR-103
Sequence

48 -  

agcagcauuguacagggcuauga

 - 70

Get sequence
Evidence by similarity; MI0000109
Predicted targets

References

1
"Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).