Stem-loop sequence age-mir-103

Accession MI0002738
Description Ateles geoffroyi miR-103 stem-loop
Gene family MIPF0000024; mir-103
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uac    c  --    u  u           c   u g a 
   ugcc uc  ggcu cu uacagugcugc uug u c u
   |||| ||  |||| || ||||||||||| ||| | |  
   acgg ag  ucgg ga auguuacgacg aac a g a
guu    a  ua    -  c           -   u g u 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence age-miR-103

Accession MIMAT0002442
Sequence

48 - 

agcagcauuguacagggcuauga

 - 70

Get sequence
Evidence by similarity; MI0000109

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).