Stem-loop sequence mne-mir-29b

AccessionMI0002736 (change log)
DescriptionMacaca nemestrina miR-29b stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
            -          c      g  u    uuuucc 
5' cuucuggaa gcugguuuca auggug cu agau      a
   ||||||||| |||||||||| |||||| || ||||       
3' gaggauuuu ugacuaaagu uaccac ga ucua      u
            g          u      -  -    uguuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-29b

Accession MIMAT0002441
Sequence

52 - 

uagcaccauuugaaaucagu

 - 71

Get sequence
Evidence by similarity; MI0000107

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).