Stem-loop sequence ppy-mir-29b-2

AccessionMI0002734 (change log)
DescriptionPongo pygmaeus miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
            -          c      g  u    uuuucc 
5' cuucuggaa gcugguuuca auggug cu agau      a
   ||||||||| |||||||||| |||||| || ||||       
3' gaggauuuu ugacuaaagu uaccac ga ucua      u
            g          u      -  -    uguuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 42327544-42327624 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-29b-2
ppy-mir-29b-2chr1: 42327544-42327624 [+]
ppy-mir-29cchr1: 42328128-42328215 [+]
Database links

Mature sequence ppy-miR-29b

Accession MIMAT0002434
Sequence

52 - 

uagcaccauuugaaaucagu

 - 71

Get sequence
Evidence by similarity; MI0000107

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).