Stem-loop sequence ptr-mir-29b-1

AccessionMI0002727 (change log)
DescriptionPan troglodytes miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   -         -          u      gu      uuaaa 
5'  cuucaggaa gcugguuuca auggug  uuagau     u
    ||||||||| |||||||||| ||||||  ||||||     a
3'  gggguucuu ugacuaaagu uaccac  gaucug     g
   g         g          u      --      uuagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr7: 135425101-135425181 [-]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-29b-1
ptr-mir-29b-1chr7: 135425101-135425181 [-]
ptr-mir-29achr7: 135424388-135424451 [-]
Database links

Mature sequence ptr-miR-29b

Accession MIMAT0002435
Sequence

51 - 

uagcaccauuugaaaucagu

 - 70

Get sequence
Evidence by similarity; MI0000107
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).