Stem-loop sequence mml-mir-101-1

AccessionMI0002723 (change log)
Previous IDsmml-mir-101
DescriptionMacaca mulatta miR-101-1 stem-loop
Gene family MIPF0000046; mir-101
Literature search

1 open access papers mention mml-mir-101-1
(1 sentences)

Stem-loop
   u   cuggc                  a    gucca 
5'  gcc     ucaguuaucacagugcug ugcu     u
    |||     |||||||||||||||||| ||||      
3'  cgg     agucaauagugucaugac augg     u
   a   uagga                  -    aaauc 
Get sequence
Deep sequencing
3446383 reads, 2.14e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 64744969-64745043 [-]
intergenic
Database links

Mature sequence mml-miR-101-1-5p

Accession MIMAT0026581
Sequence

10 - 

ucaguuaucacagugcugaugcu

 - 32

Get sequence
Deep sequencing1824 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-101-3p

Accession MIMAT0002431
Sequence

47 - 

uacaguacugugauaacugaag

 - 68

Get sequence
Deep sequencing6891688 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).