Stem-loop sequence ptr-mir-101-1

AccessionMI0002722 (change log)
Previous IDsptr-mir-101
DescriptionPan troglodytes miR-101-1 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
   u   cuggc                  a    gucca 
5'  gcc     ucaguuaucacagugcug ugcu     u
    |||     |||||||||||||||||| ||||      
3'  cgg     agucaauagugucaugac augg     u
   a   uagga                  -    aaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 64978366-64978440 [-]
sense
ENSPTRT00000054341 ; ptr-mir-101-1-201; exon 1
Database links

Mature sequence ptr-miR-101

Accession MIMAT0002430
Sequence

47 - 

uacaguacugugauaacugaag

 - 68

Get sequence
Evidence by similarity; MI0000739
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).