Dead miRNA entry

miRNA accession:
MI0002721
miRNA ID:
ppy-mir-101-3
Forward to:
MI0014811
Comment:
The 3 annotated mir-101 sequences map to just 2 loci in the P_pygmaeus_2.0.2 genome assembly. The entries are rationalised and merged.

Previous miRNA entry

Stem-loop sequence ppy-mir-101-3

AccessionMI0002721 (change log)
Previous IDsppy-mir-101
DescriptionPongo pygmaeus miR-101-3 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
   u   cuggc                  a    gucua 
5'  gcc     ucaguuaucacagugcug ugcu     u
    |||     |||||||||||||||||| ||||      
3'  cgg     agucaauagugucaugac augg     u
   a   uagga                  -    aaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence ppy-miR-101

Accession MIMAT0002429
Sequence

47 - 

uacaguacugugauaacugaa

 - 67

Get sequence
Evidence not experimental

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).