|
miRBase |
|
Stem-loop sequence sla-mir-100 |
|
| Accession | MI0002715 |
| Description | Saguinus labiatus miR-100 stem-loop |
| Gene family | MIPF0000025; mir-99 |
| Stem-loop |
-uu c a cg uc a g ug u ccug g caca acc uaga cga cuugu g u a |||| | |||| ||| |||| ||| ||||| | | ggau c gugu ugg aucu guu gaaca c g a ugu u a au gu c - gu u |
| Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
| Database links |
|
Mature sequence sla-miR-100 |
|
| Accession | MIMAT0002423 |
| Sequence |
13 - aacccguagauccgaacuugug - 34 |
| Evidence | by similarity; MI0000102 |
| Predicted targets |
|
References |
|
| 1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|