Stem-loop sequence mml-mir-100

AccessionMI0002714 (change log)
DescriptionMacaca mulatta miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention mml-mir-100
(2 sentences)

Stem-loop
       -uu c    a   cg    uc   a      - uau 
5' ccug   g caca acc  uaga  cga cuugug g   u
   ||||   | |||| |||  ||||  ||| |||||| |    
3' ggau   c gugu ugg  aucu  guu gaacac c   a
       uuu u    a   au    gu   c      g cug 
Get sequence
Deep sequencing
1830911 reads, 1.25e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 115006675-115006754 [-]
antisense
ENSMMUT00000008946 ; CCDC15-201; intron 4
Clustered miRNAs
< 10kb from mml-mir-100
mml-mir-100chr14: 115006675-115006754 [-]
mml-let-7a-2chr14: 115000985-115001056 [-]
Database links

Mature sequence mml-miR-100-5p

Accession MIMAT0002422
Sequence

13 - 

aacccguagauccgaacuugug

 - 34

Get sequence
Deep sequencing1830821 reads, 9 experiments
Evidence experimental; cloned [1], Illumina [3]
Database links
Predicted targets

Mature sequence mml-miR-100-3p

Accession MIMAT0026580
Sequence

49 - 

aagcuugugucuauagguaug

 - 69

Get sequence
Deep sequencing90 reads, 7 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).