|
miRBase |
|
Stem-loop sequence ppa-mir-99a |
|
| Accession | MI0002708 |
| Description | Pan paniscus miR-99a stem-loop |
| Gene family | MIPF0000025; mir-99 |
| Stem-loop |
cc a uc u g aag cauuggcaua acccguaga cga cuugug ug u |||||||||| ||||||||| ||| |||||| || gugacugugu uggguaucu gcu gaacac gc g gu c uc c - cag |
| Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
| Database links |
|
Mature sequence ppa-miR-99a |
|
| Accession | MIMAT0002416 |
| Sequence |
13 - aacccguagauccgaucuugug - 34 |
| Evidence | by similarity; MI0000101 |
| Predicted targets |
|
References |
|
| 1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|