Stem-loop sequence mml-mir-99a

AccessionMI0002702 (change log)
DescriptionMacaca mulatta miR-99a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   cc          a         uc   u      g  aag 
5'   cauuggcaua acccguaga  cga cuugug ug   u
     |||||||||| |||||||||  ||| |||||| ||    
3'   gugacugugu uggguaucu  gcu gaacac gc   g
   gu          c         uc   c      -  cag 
Get sequence
Deep sequencing
1757889 reads, 1.24e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 31071139-31071219 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-99a
mml-mir-99achr3: 31071139-31071219 [-]
mml-let-7cchr3: 31070403-31070486 [-]
Database links

Mature sequence mml-miR-99a-5p

Accession MIMAT0002410
Sequence

13 - 

aacccguagauccgaucuugug

 - 34

Get sequence
Deep sequencing1754512 reads, 9 experiments
Evidence experimental; cloned [1], Illumina [3]
Database links
Predicted targets

Mature sequence mml-miR-99a-3p

Accession MIMAT0026579
Sequence

51 - 

aagcucgcuucuaugggucug

 - 71

Get sequence
Deep sequencing3376 reads, 9 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).