Stem-loop sequence ppa-mir-31

AccessionMI0002676 (change log)
DescriptionPan paniscus miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
         ga     g   c         -u   gaa 
5' ggagag  ggcaa aug uggcauagc  guu   c
   ||||||  ||||| ||| |||||||||  |||    
3' ccuuuc  ccguu uac accguaucg  caa   u
         ua     a   a         uc   ggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr9: 21990168-21990238 [-]
intergenic
Database links

Mature sequence ppa-miR-31

Accession MIMAT0002384
Sequence

9 - 

ggcaagaugcuggcauagcug

 - 29

Get sequence
Evidence by similarity; MI0000089

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).