Stem-loop sequence ptr-mir-31

Accession MI0002672
Description Pan troglodytes miR-31 stem-loop
Gene family MIPF0000064; mir-31
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-31. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-31 has been characterised as a tumour suppressor miRNA, with its levels varying in breast cancer cells according to the metastatic state of the tumour. From its typical abundance in healthy tissue is a moderate decrease in non-metastatic breast cancer cell lines, and levels are almost completely absent in mouse and human metastatic breast cancer cell lines. There has also been observed a strong encapsulation of tumour cells expressing miR-31, as well as a reduced cell survival rate. miR-31's antimetastatic effects therefore make it a potential therapeutic target for breast cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      ga     g   c         -u   gaa 
ggagag  ggcaa aug uggcauagc  guu   c
||||||  ||||| ||| |||||||||  |||    
ccuuuc  ccguu uac accguaucg  caa   u
      ua     a   a         uc   ggg 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (PanTro2.1.4) Overlapping transcripts
9: 21845803-21845873 [-]
intergenic
Database links

Mature sequence ptr-miR-31

Accession MIMAT0002380
Sequence

9 - 

ggcaagaugcuggcauagcug

 - 29

Get sequence
Evidence by similarity; MI0000089

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).