Stem-loop sequence mml-mir-31

AccessionMI0002671 (change log)
DescriptionMacaca mulatta miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
         ga     g   c         -u   gaa 
5' ggagag  ggcaa aug uggcauagc  guu   c
   ||||||  ||||| ||| |||||||||  |||    
3' ccuuuc  ccguu uac accguaucg  caa   u
         ua     a   a         uc   ggg 
Get sequence
Deep sequencing
4665 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 62389947-62390017 [+]
sense
ENSMMUT00000011644 ; MLLT3-201; intron 2
Database links

Mature sequence mml-miR-31-5p

Accession MIMAT0002379
Sequence

9 - 

ggcaagaugcuggcauagcug

 - 29

Get sequence
Deep sequencing4628 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-31-3p

Accession MIMAT0026577
Sequence

45 - 

gcuaugccaacauauugccauc

 - 66

Get sequence
Deep sequencing33 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).