Stem-loop sequence ppy-mir-30a

Accession MI0002669
Description Pongo pygmaeus miR-30a stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a            uc           -----   a 
gcg cuguaaacaucc  gacuggaagcu     gug a
||| ||||||||||||  |||||||||||     |||  
cgu gacguuuguagg  cugacuuucgg     cac g
   c            --           guaga   c 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (PPYG2) Overlapping transcripts
6: 71836911-71836981 [-]
intergenic
Database links

Mature sequence ppy-miR-30a-5p

Accession MIMAT0002375
Sequence

6 - 

uguaaacauccucgacuggaag

 - 27

Get sequence
Evidence by similarity; MI0000088
Predicted targets

Mature sequence ppy-miR-30a-3p

Accession MIMAT0002376
Sequence

47 - 

cuuucagucggauguuugcagc

 - 68

Get sequence
Evidence by similarity; MI0000088
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).