Stem-loop sequence sla-mir-29a

AccessionMI0002663 (change log)
DescriptionSaguinus labiatus miR-29a stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
               uuu       c    ucaa 
5' augacugauuuc   ugguguu agag    u
   ||||||||||||   ||||||| ||||    a
3' uauuggcuaaag   accacga ucuu    u
               ucu       -    uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence sla-miR-29a

Accession MIMAT0002366
Sequence

41 - 

cuagcaccaucugaaaucgguu

 - 62

Get sequence
Evidence by similarity; MI0000087

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).