Stem-loop sequence mml-mir-29a

AccessionMI0002662 (change log)
DescriptionMacaca mulatta miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

6 open access papers mention mml-mir-29a
(7 sentences)

Stem-loop
               uuu       c    ucaa 
5' augacugauuuc   ugguguu agag    u
   ||||||||||||   ||||||| ||||    a
3' uauuggcuaaag   accacga ucuu    u
               ucu       -    uuaa 
Get sequence
Deep sequencing
834217 reads, 4.68e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 157003023-157003086 [-]
sense
ENSMMUT00000007228 ; PLXNA4-201; intron 1
ENSMMUT00000041772 ; PLXNA4-202; intron 3
Clustered miRNAs
< 10kb from mml-mir-29a
mml-mir-29b-1chr3: 157003735-157003815 [-]
mml-mir-29achr3: 157003023-157003086 [-]
Database links

Mature sequence mml-miR-29a-5p

Accession MIMAT0026576
Sequence

5 - 

cugauuucuuuugguguucaga

 - 26

Get sequence
Deep sequencing2161 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-29a-3p

Accession MIMAT0002365
Sequence

41 - 

cuagcaccaucugaaaucgguu

 - 62

Get sequence
Deep sequencing832056 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).