Stem-loop sequence ggo-mir-29a

AccessionMI0002657 (change log)
DescriptionGorilla gorilla miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

1 open access papers mention ggo-mir-29a
(1 sentences)

Stem-loop
               uuu       c    ucaa 
5' augacugauuuc   ugguguu agag    u
   ||||||||||||   ||||||| ||||    a
3' uauuggcuaaag   accacga ucuu    u
               ucu       -    uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr7: 130188804-130188867 [-]
sense
ENSGGOT00000039022 ; ggo-mir-29a-201; exon 1
Clustered miRNAs
< 10kb from ggo-mir-29a
ggo-mir-29b-1chr7: 130189494-130189574 [-]
ggo-mir-29achr7: 130188804-130188867 [-]
Database links

Mature sequence ggo-miR-29a

Accession MIMAT0002360
Sequence

41 - 

cuagcaccaucugaaaucgguu

 - 62

Get sequence
Evidence by similarity; MI0000087

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).