Stem-loop sequence mml-mir-28

AccessionMI0002649 (change log)
DescriptionMacaca mulatta miR-28 stem-loop
Gene family MIPF0000057; mir-28
Literature search

1 open access papers mention mml-mir-28
(1 sentences)

Stem-loop
      c         a                u  ----    ucc 
5' ggu cuugcccuc aggagcucacagucua ug    aguu   u
   ||| ||||||||| |||||||||||||||| ||    ||||    
3' uca ggacgggag uccucgaguguuagau ac    ucag   u
      c         g                c  ccuu    ugu 
Get sequence
Deep sequencing
180978 reads, 1.06e+03 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 190962046-190962131 [-]
intergenic
Database links

Mature sequence mml-miR-28-5p

Accession MIMAT0002352
Sequence

14 - 

aaggagcucacagucuauugag

 - 35

Get sequence
Deep sequencing91233 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-28-3p

Accession MIMAT0026575
Sequence

54 - 

cacuagauugugagcuccugga

 - 75

Get sequence
Deep sequencing89742 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).