Stem-loop sequence mml-mir-26a-1

AccessionMI0002646 (change log)
Previous IDsmml-mir-26a
DescriptionMacaca mulatta miR-26a-1 stem-loop
Gene family MIPF0000043; mir-26
Literature search

3 open access papers mention mml-mir-26a-1
(7 sentences)

Stem-loop
      g      u         c          --g  ca 
5' gug ccucgu caaguaauc aggauaggcu   ug  g
   ||| |||||| ||||||||| ||||||||||   ||  g
3' cgc ggggca guucauugg ucuuauccgg   ac  u
      a      c         u          gua  cc 
Get sequence
Deep sequencing
884409 reads, 5.49e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 104778007-104778083 [-]
intergenic
Database links

Mature sequence mml-miR-26a-5p

Accession MIMAT0002349
Sequence

10 - 

uucaaguaauccaggauaggcu

 - 31

Get sequence
Deep sequencing1768705 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-26a-1-3p

Accession MIMAT0026574
Sequence

49 - 

ccuauucuugguuacuugcacg

 - 70

Get sequence
Deep sequencing71 reads, 7 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).