Stem-loop sequence mne-mir-26a

AccessionMI0002645 (change log)
DescriptionMacaca nemestrina miR-26a stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
      g      u         c          --g  ca 
5' gug ccucgu caaguaauc aggauaggcu   ug  g
   ||| |||||| ||||||||| ||||||||||   ||  g
3' cgc ggggca guucauuag ucuuauccgg   ac  u
      a      c         u          gua  cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-26a

Accession MIMAT0002348
Sequence

10 - 

uucaaguaauccaggauaggcu

 - 31

Get sequence
Evidence by similarity; MI0000083

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).