![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptr-mir-26a-1 |
|||||
Accession | MI0002641 (change log) | ||||
Previous IDs | ptr-mir-26a | ||||
Description | Pan troglodytes miR-26a-1 stem-loop | ||||
Gene family | MIPF0000043; mir-26 | ||||
Stem-loop |
g u c --g ca 5' gug ccucgu caaguaauc aggauaggcu ug g ||| |||||| ||||||||| |||||||||| || g 3' cgc ggggca guucauugg ucuuauccgg ac u a c u gua cc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
||||
Genome context |
|
||||
Database links |
Mature sequence ptr-miR-26a |
|
Accession | MIMAT0002344 |
Sequence |
10 - uucaaguaauccaggauaggcu - 31 |
Evidence | by similarity; MI0000750 |
Predicted targets |
|
References |
|
1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|