Stem-loop sequence mml-mir-24-1

AccessionMI0002637 (change log)
DescriptionMacaca mulatta miR-24-1 stem-loop
Gene family MIPF0000041; mir-24
Literature search

2 open access papers mention mml-mir-24-1
(3 sentences)

Stem-loop
       g  g   a         ua     ucuca 
5' cucc gu ccu cugagcuga  ucagu     u
   |||| || ||| |||||||||  |||||     u
3' gagg ca gga gacuugacu  gguca     u
       a  a   c         -c     cacau 
Get sequence
Deep sequencing
1299833 reads, 8.03e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 108904876-108904943 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-24-1
mml-mir-23bchr15: 108904067-108904163 [+]
mml-mir-27bchr15: 108904304-108904400 [+]
mml-mir-24-1chr15: 108904876-108904943 [+]
Database links

Mature sequence mml-miR-24-5p

Accession MIMAT0002336
Previous IDsmml-miR-189;mml-miR-24*
Sequence

6 - 

gugccuacugagcugauaucagu

 - 28

Get sequence
Deep sequencing824 reads, 7 experiments
Evidence by similarity; MI0000080
Predicted targets

Mature sequence mml-miR-24-3p

Accession MIMAT0002337
Previous IDsmml-miR-24
Sequence

44 - 

uggcucaguucagcaggaacag

 - 65

Get sequence
Deep sequencing2596523 reads, 9 experiments
Evidence by similarity; MI0000081
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).