Stem-loop sequence mne-mir-21

Accession MI0002625
Description Macaca nemestrina miR-21 stem-loop
Gene family MIPF0000060; mir-21
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MIRN21. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

microRNA 21 also known as hsa-mir-21 or miRNA21 is a mammalian microRNA that is encoded by the MIR21 gene. MIRN21 was one of the first mammalian microRNAs identified. The mature miR-21 sequence is strongly conserved throughout evolution. The human microRNA-21 gene is located on plus strand of chromosome 17q23.2 (55273409–55273480) within a coding gene TMEM49 (also called vacuole membrane protein). Despite being located in intronic regions of a coding gene in the direction of transcription, it has its own promoter regions and forms a ~3433-nt long primary transcript of miR-21 (known as pri-miR-21) which is independently transcribed. The stem–loop recursor of miR-21(pre-miR-21) resides between nucleotides 2445 and 2516 of pri-miR-21.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u     gu        a     a     a    u a 
 gucgg  agcuuauc gacug uguug cugu g a
 |||||  |||||||| ||||| ||||| |||| | u
 caguc  ucggguag cugac acaac ggua c c
a     ug        -     c     -    - u 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-21

Accession MIMAT0002324
Sequence

8 - 

uagcuuaucagacugauguuga

 - 29

Get sequence
Evidence by similarity; MI0000077
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).