Stem-loop sequence ppa-mir-195

AccessionMI0002618 (change log)
DescriptionPan paniscus miR-195 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   a   u     g  cu          -a          caggga 
5'  gcu cccug cu  agcagcacag  aauauuggca      a
    ||| ||||| ||  ||||||||||  ||||||||||       
3'  ugg gggac ga  ucgucguguc  uuauaaccgu      g
   g   u     g  cc          gg          cugagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr17: 7036725-7036811 [-]
intergenic
Database links

Mature sequence ppa-miR-195

Accession MIMAT0002317
Sequence

15 - 

uagcagcacagaaauauuggc

 - 35

Get sequence
Evidence by similarity; MI0000489

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).