Stem-loop sequence ggo-mir-195

AccessionMI0002617 (change log)
DescriptionGorilla gorilla miR-195 stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention ggo-mir-195
(7 sentences)

Stem-loop
   a   u     g  cu          -a          caggga 
5'  gcu cccug cu  agcagcacag  aauauuggca      a
    ||| ||||| ||  ||||||||||  ||||||||||       
3'  ugg gggac ga  ucgucguguc  uuauaaccgu      g
   g   u     g  cc          gg          cugagc 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr17: 7023321-7023407 [-]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-195
ggo-mir-497chr17: 7023616-7023724 [-]
ggo-mir-195chr17: 7023321-7023407 [-]
Database links

Mature sequence ggo-miR-195

Accession MIMAT0002316
Sequence

15 - 

uagcagcacagaaauauuggc

 - 35

Get sequence
Evidence by similarity; MI0000489

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).