|
miRBase |
|
miRBase has moved to http://www.mirbase.org/ - please update your links.
Stem-loop sequence MI0002613 |
|||||
| Accession | MI0002613 | ||||
| ID | mml-mir-190a | ||||
| Description | Macaca mulatta miR-190a stem-loop | ||||
| Stem-loop |
u c u - ug ua uuau gcagg c cugu g auauguuugauauau gguug u ||||| | |||| | ||||||||||||||| ||||| cguuc g gaca c uauacaaacuauaua ucaac u c u u u cu -- cuaa |
||||
| Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
||||
| Genome context |
|
||||
| Database links |
|
||||
| Gene family |
MIPF0000076; mir-190 |
||||
Mature sequence MIMAT0002312 |
|
| Accession | MIMAT0002312 |
| ID | mml-miR-190a |
| Sequence |
15 - ugauauguuugauauauuaggu - 36 |
| Evidence | by similarity; MI0000486 |
| Predicted targets |
|
References |
|
| 1 |
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|