Stem-loop sequence mml-mir-190a

AccessionMI0002613 (change log)
Previous IDsmml-mir-190
DescriptionMacaca mulatta miR-190a stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   u     c u    - ug               ua     uuau 
5'  gcagg c cugu g  auauguuugauauau  gguug    u
    ||||| | |||| |  |||||||||||||||  |||||     
3'  cguuc g gaca c  uauacaaacuauaua  ucaac    u
   c     u u    u cu               --     cuaa 
Get sequence
Deep sequencing
17986 reads, 44.4 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 39416819-39416903 [+]
intergenic
Database links

Mature sequence mml-miR-190a-5p

Accession MIMAT0002312
Previous IDsmml-miR-190
Sequence

15 - 

ugauauguuugauauauuaggu

 - 36

Get sequence
Deep sequencing17931 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-190a-3p

Accession MIMAT0026572
Sequence

52 - 

cuauauaucaaacauauuccu

 - 72

Get sequence
Deep sequencing55 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).