Stem-loop sequence ggo-mir-134

Accession MI0002589
Description Gorilla gorilla miR-134 stem-loop
Gene family MIPF0000112; mir-134
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-134. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-134 is a family of microRNA precursors found in mammals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-134 precursor is the microRNA mir-134. miR-134 was one of a number of microRNAs found to be increasingly expressed in schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u     gu        u  -a   g    ---    g 
 agggu  gugacugg ug  cca aggg   gcau c
 |||||  |||||||| ||  ||| ||||   |||| a
 uccca  cacugauc ac  ggu uccc   ugug c
c     ac        c  cg   g    acu    u 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor3) Overlapping transcripts
14: 83032548-83032620 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-134
ggo-mir-381 14: 83023756-83023863 [+]
ggo-mir-487b 14: 83024293-83024402 [+]
ggo-mir-889 14: 83025734-83025843 [+]
ggo-mir-655 14: 83027393-83027500 [+]
ggo-mir-487a 14: 83030285-83030394 [+]
ggo-mir-134 14: 83032548-83032620 [+]
ggo-mir-668 14: 83033090-83033200 [+]
ggo-mir-485 14: 83033268-83033376 [+]
ggo-mir-323b 14: 83034060-83034167 [+]
ggo-mir-154 14: 83037628-83037711 [+]
ggo-mir-496 14: 83038442-83038551 [+]
ggo-mir-377 14: 83039912-83040020 [+]
Database links

Mature sequence ggo-miR-134

Accession MIMAT0002288
Sequence

8 - 

ugugacugguugaccagaggg

 - 28

Get sequence
Evidence by similarity; MI0000474
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).