miRNA Entry for MI0002588

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-127. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-127

miR-127 microRNA secondary structure and sequence conservation
Identifiers
Symbol	mir-127
Rfam	RF00676
miRBase family	MIPF0000080
Entrez	406914
HUGO	31509
OMIM	611709
Other data
RNA type	microRNA
Domain(s)	Eukaryota;

mir-127 microRNA is a short non-coding RNA molecule with interesting overlapping gene structure. miR-127 functions to regulate the expression levels of genes involved in lung development, placental formation and apoptosis. Aberrant expression of miR-127 has been linked to different cancers.

1 Gene structure
2 Transcription regulation
3 Functional roles
- 3.1 Down-regulation of the imprinted gene Rtl1
- 3.2 Control of fetal lung development
4 Role in disease
- 4.1 Diffuse large B-cell lymphoma
- 4.2 Hepatocellular carcinoma
5 See also
6 References
7 Further reading
8 External links

Gene structure[edit]

pri-miR-127 is derived from a separate but overlapping conserved gene cluster coding for miR-433/127. miR-127 and miR-433 are overlapped in a 5’-3’ direction.^[1] Although the loci could be found on different chromosomes in different species, the structure has been conserved. In mammals including human, chimpanzee, horse, dog, monkey, rat, cow, and mouse, multiple sequence alignments (MSA) between miR-433 and miR127 have shown 95-100% similarity with a conserved distance between miR-433 and miR-127 of 986 to 1007 bp. Moreover, the upstream response elements in the miR-433/127 promoters, including estrogen related receptors response element (ERRE) have been conserved among above species. Data have suggested that that miR-433/127 loci may have evolved from a common gene of origin.^[2]

Transcription regulation[edit]

Transcription factor binding sites positioned upstream of miRNA precursor play a role in regulating transcription. Activation of miR-127 and miR-433 promoters is mediated by estrogen-related receptor gamma (ERRgamma, NR3B3), which physically associates with their endogenous promoters. Inhibition is regulated by small heterodimer parter (SHP), which acts in trans.^[3] Although miR-127 and miR-433 have common regulatory elements, they have independent promoters and their differential expression pattern is observed.^[4]

Functional roles[edit]

Down-regulation of the imprinted gene Rtl1[edit]

Rtl1 is a key gene in placenta formation and the loss or overexpression of Rlt1 have led to late-fetal or neonatal lethality in mice.^[5] miR-127 is located near CpG islands in the imprinted region encoding rtl1 and is normally transcribed in an antisense orientation to the gene. Ectopic expression of miR-127 resulted in a reduction in Rtl1 expression in Human Hela cell and mouse Heppa-1.

Experiments performed in mice showed that Rtl1 was only transcribed from the paternal chromosome, while the maternal allele was degraded. miR-127 and miR-136 however, are only maternally expressed in the somatic cells and thus play a role in antisense regulation of Rtl1 imprinting. Aberrant methylation status of Rtl1 and miR-127 indicated that epigenetic programming is also involved in the process.^[2]

Control of fetal lung development[edit]

miR-127 is highly expressed in late state of fetal development. A disruption to the system by overexpressing miR-127 in a fetal lung organ culture system resulted in defective development shown by a decrease in terminal bud counts and varied bud sizes.^[6]

Role in disease[edit]

Diffuse large B-cell lymphoma[edit]

Upregulation of miR-127 caused a downregulation of B-cell lymphoma 6 protein, a proto-oncogene which is usually hypermutated in diffuse large B-cell lymphoma (DLCL).^[7]^[8] Moreover, differential expression of miR-127 was detected in different type of DLCL. miR-127 levels were significantly higher in the testicular DLCL compared with the nodal and central nervous system DLCL, implying different biological entity of DLCL in different locations.^[9]

Hepatocellular carcinoma[edit]

Inhibition of miR-127 expression is linked with Hepatocellular carcinoma. The mechanistic link was confirmed by a change in BCL6 protein, which is targeted by miR-127.^[10]

References[edit]

^ Song G, Wang L (2008). "MiR-433 and miR-127 arise from independent overlapping primary transcripts encoded by the miR-433-127 locus". In Volff, Jean-Nicolas. PLoS ONE 3 (10): e3574. doi:10.1371/journal.pone.0003574. PMC 2570487. PMID 18974780.
^ ^a ^b Song G, Wang L (2009). "A conserved gene structure and expression regulation of miR-433 and miR-127 in mammals". In Tora, Laszlo. PLoS ONE 4 (11): e7829. doi:10.1371/journal.pone.0007829. PMC 2778354. PMID 19946636.
^ Wang L, Liu J, Saha P, et al. (October 2005). "The orphan nuclear receptor SHP regulates PGC-1alpha expression and energy production in brown adipocytes". Cell Metab. 2 (4): 227–38. doi:10.1016/j.cmet.2005.08.010. PMID 16213225.
^ Song G, Wang L (October 2008). "Transcriptional mechanism for the paired miR-433 and miR-127 genes by nuclear receptors SHP and ERRgamma". Nucleic Acids Res. 36 (18): 5727–35. doi:10.1093/nar/gkn567. PMC 2566885. PMID 18776219.
^ Sekita Y, Wagatsuma H, Nakamura K, et al. (February 2008). "Role of retrotransposon-derived imprinted gene, Rtl1, in the feto-maternal interface of mouse placenta". Nat. Genet. 40 (2): 243–8. doi:10.1038/ng.2007.51. PMID 18176565.
^ Bhaskaran M, Wang Y, Zhang H, et al. (May 2009). "MicroRNA-127 modulates fetal lung development". Physiol. Genomics 37 (3): 268–78. doi:10.1152/physiolgenomics.90268.2008. PMC 2685501. PMID 19439715.
^ Lu J, Getz G, Miska EA, et al. (June 2005). "MicroRNA expression profiles classify human cancers". Nature 435 (7043): 834–8. doi:10.1038/nature03702. PMID 15944708.
^ Saito Y, Liang G, Egger G, et al. (June 2006). "Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells". Cancer Cell 9 (6): 435–43. doi:10.1016/j.ccr.2006.04.020. PMID 16766263.
^ Robertus JL, Harms G, Blokzijl T, et al. (April 2009). "Specific expression of miR-17-5p and miR-127 in testicular and central nervous system diffuse large B-cell lymphoma". Mod. Pathol. 22 (4): 547–55. doi:10.1038/modpathol.2009.10. PMID 19287466.
^ Tryndyak VP, Ross SA, Beland FA, Pogribny IP (June 2009). "Down-regulation of the microRNAs miR-34a, miR-127, and miR-200b in rat liver during hepatocarcinogenesis induced by a methyl-deficient diet". Mol. Carcinog. 48 (6): 479–87. doi:10.1002/mc.20484. PMID 18942116.

External links[edit]

Page for mir-127 microRNA precursor family at Rfam

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

Mature sequence age-miR-127
Accession	MIMAT0002287
Sequence	57 - ucggauccgucugagcuuggcu - 78 Get sequence
Evidence	by similarity; MI0000472

miRBase

Stem-loop sequence age-mir-127

Contents