Stem-loop sequence age-mir-127

AccessionMI0002588 (change log)
DescriptionAteles geoffroyi miR-127 stem-loop
Gene family MIPF0000080; mir-127
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-127. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-127 microRNA is a short non-coding RNA molecule with interesting overlapping gene structure. miR-127 functions to regulate the expression levels of genes involved in lung development, placental formation and apoptosis. Aberrant expression of miR-127 has been linked to different cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -----  u   ca   ucu      ugcug         g  c      --  a 
5'      ug gau  cug   ccagcc     aagcucaga gg ucugau  uc g
        || |||  |||   ||||||     ||||||||| || ||||||  || a
3'      ac cug  ggc   ggucgg     uucgagucu cc aggcua  ag a
   cuacu  u   aa   --u      -----         g  u      cu  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence age-miR-127

Accession MIMAT0002287
Sequence

57 - 

ucggauccgucugagcuuggcu

 - 78

Get sequence
Evidence by similarity; MI0000472

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).