Stem-loop sequence mml-mir-127

AccessionMI0002582 (change log)
DescriptionMacaca mulatta miR-127 stem-loop
Gene family MIPF0000080; mir-127
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-127. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-127 microRNA is a short non-coding RNA molecule with interesting overlapping gene structure. miR-127 functions to regulate the expression levels of genes involved in lung development, placental formation and apoptosis. Aberrant expression of miR-127 has been linked to different cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -----ugu   ca   ucu      ugcug         g  c      --  a 
5'         gau  cug   ccagcc     aagcucaga gg ucugau  uc g
           |||  |||   ||||||     ||||||||| || ||||||  || a
3'         cug  ggc   ggucgg     uucgagucu cc aggcua  ag a
   cuacuccu   aa   --u      -----         g  u      cu  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163217177-163217273 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-127
mml-mir-337chr7: 163207975-163208067 [+]
mml-mir-665chr7: 163208516-163208587 [+]
mml-mir-431chr7: 163215205-163215318 [+]
mml-mir-433chr7: 163216084-163216176 [+]
mml-mir-127chr7: 163217177-163217273 [+]
mml-mir-432chr7: 163218684-163218777 [+]
mml-mir-136chr7: 163218898-163218989 [+]
Database links

Mature sequence mml-miR-127-5p

Accession MIMAT0026570
Sequence

24 - 

ugaagcucagagggcucugauu

 - 45

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-127-3p

Accession MIMAT0002281
Sequence

57 - 

ucggauccgucugagcuuggcu

 - 78

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).