Stem-loop sequence lla-mir-9

AccessionMI0002571 (change log)
DescriptionLagothrix lagotricha miR-9 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   g    c     g   uc               g      ug a 
5'  gaag gaguu uua  uuugguuaucuagcu uaugag  u u
    |||| ||||| |||  ||||||||||||||| ||||||  |  
3'  cuuc cucaa aau  aagccaauagaucga auacuu  g u
   a    -     a   ga               a      cu g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence lla-miR-9

Accession MIMAT0002277
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Evidence by similarity; MI0000467

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).