Stem-loop sequence mml-mir-153-2

AccessionMI0002566 (change log)
DescriptionMacaca mulatta miR-153-2 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   a     gg      -             gu       -a  aa 
5'  gcggu  ccagug ucauuuuugugau  ugcagcu  gu  u
    |||||  |||||| |||||||||||||  |||||||  ||  a
3'  uguca  gguuac agugaaaacacug  acguuga  cg  u
   g     aa      u             au       cc  ag 
Get sequence
Deep sequencing
7804 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 184009317-184009403 [-]
intergenic
Database links

Mature sequence mml-miR-153-2-5p

Accession MIMAT0031060
Sequence

15 - 

ucauuuuugugauguugcagcu

 - 36

Get sequence
Deep sequencing326 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-153-3p

Accession MIMAT0002271
Sequence

53 - 

uugcauagucacaaaaguga

 - 72

Get sequence
Deep sequencing14956 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).