Stem-loop sequence mml-mir-153-1

AccessionMI0002563 (change log)
DescriptionMacaca mulatta miR-153-1 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   c     g         -             -c       --   au 
5'  ucaca cugccagug ucauuuuugugau  ugcagcu  agu  u
    ||||| ||||||||| |||||||||||||  |||||||  |||   
3'  ggugu gacgguuac agugaaaacacug  acguuga  uca  c
   c     g         u             au       cc   cu 
Get sequence
Deep sequencing
7660 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr12: 101425493-101425582 [-]
intergenic
Database links

Mature sequence mml-miR-153-1-5p

Accession MIMAT0026569
Sequence

17 - 

ucauuuuugugaucugcagcu

 - 37

Get sequence
Deep sequencing181 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-153-3p

Accession MIMAT0002271
Sequence

54 - 

uugcauagucacaaaaguga

 - 73

Get sequence
Deep sequencing14956 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).