Stem-loop sequence ppa-mir-144

AccessionMI0002557 (change log)
DescriptionPan paniscus miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
   -u   -    u      g        a         -a    gc 
5'   ggg gccc ggcugg auaucauc uauacugua  guuu  g
     ||| |||| |||||| |||||||| |||||||||  ||||   
3'   ccc cggg cugauc uguaguag auaugacau  caga  a
   cu   a    c      a        -         ca    gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chr17: 28421578-28421663 [+]
intergenic
Database links

Mature sequence ppa-miR-144

Accession MIMAT0002265
Sequence

52 - 

uacaguauagaugauguacuag

 - 73

Get sequence
Evidence by similarity; MI0000460

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).