Stem-loop sequence mne-mir-144

AccessionMI0002556 (change log)
DescriptionMacaca nemestrina miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
   -u   -    u      g        a         -a    gu 
5'   ggg gccc ggcugg auaucauc uauacugua  guuu  g
     ||| |||| |||||| |||||||| |||||||||  ||||   
3'   ccc cggg cugauc uguaguag auaugacau  caga  a
   cc   a    c      a        -         ca    gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-144

Accession MIMAT0002264
Sequence

52 - 

uacaguauagaugauguacuag

 - 73

Get sequence
Evidence by similarity; MI0000460

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).