|
miRBase |
|
Stem-loop sequence ptr-mir-140 |
|||||
| Accession | MI0002547 | ||||
| Description | Pan troglodytes miR-140 stem-loop | ||||
| Gene family | MIPF0000085; mir-140 | ||||
| Stem-loop |
u ucucu - a a uu uc gugucuc guguccug cc gugguuuuacccu ugguagg acg a ||||||| |||||||| || ||||||||||||| ||||||| ||| cacgggg cauaggac gg caccaagauggga accaucu ugu u c ----c a - c -- cg |
||||
| Comments |
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence ptr-miR-140 |
|
| Accession | MIMAT0002255 |
| Sequence |
24 - agugguuuuacccuaugguag - 44 |
| Evidence | by similarity; MI0000456 |
| Predicted targets |
|
References |
|
| 1 |
PMID:15652478
"Phylogenetic shadowing and computational identification of human microRNA genes"
Cell. 120:21-24(2005).
|