Stem-loop sequence lla-mir-135-2

AccessionMI0002544 (change log)
DescriptionLagothrix lagotricha miR-135-2 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   -agauaaauucacucua    uuu         u            u g a 
5'                  gugc   auggcuuuu auuccuauguga a u a
                    ||||   ||||||||| |||||||||||| | | u
3'                  cacg   uaccgaagg uagggauguacu u a a
   acuaaaauguaauacac    ---         -            c g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence lla-miR-135

Accession MIMAT0002248
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Evidence by similarity; MI0000453

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).