Stem-loop sequence ppy-mir-135a-2

AccessionMI0002543 (change log)
Previous IDsppy-mir-135
DescriptionPongo pygmaeus miR-135a-2 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   a   aaa     ucua   c            u            u g a 
5'  gau   uucac    gug uuuauggcuuuu auuccuauguga a u a
    |||   |||||    ||| |||||||||||| |||||||||||| | | u
3'  cua   aagug    cau aaguaccgaagg uagggauguacu u a a
   a   -aa     -uua   a            -            c g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr12: 98797810-98797909 [+]
intergenic
Database links

Mature sequence ppy-miR-135a

Accession MIMAT0015757
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Evidence not experimental

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).