Stem-loop sequence ggo-mir-135a

AccessionMI0002542 (change log)
Previous IDsggo-mir-135
DescriptionGorilla gorilla miR-135 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   a   aaa     ucua   c            u            u g a 
5'  gau   uucac    gug uuuauggcuuuu auuccuauguga a u a
    |||   |||||    ||| |||||||||||| |||||||||||| | | u
3'  cua   aagug    cau aaguaccgaagg uagggauguacu u a a
   a   -aa     -uua   a            -            c g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr12: 97301642-97301741 [+]
intergenic
Database links

Mature sequence ggo-miR-135a

Accession MIMAT0002253
Previous IDsggo-miR-135
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Evidence by similarity; MI0000453

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).