Stem-loop sequence mml-mir-135a-2

AccessionMI0002540 (change log)
Previous IDsmml-mir-135
DescriptionMacaca mulatta miR-135a-2 stem-loop
Gene family MIPF0000028; mir-135
Literature search

1 open access papers mention mml-mir-135a-2
(2 sentences)

Stem-loop
   a   aaa     ucua   c            u            u g a 
5'  gau   uucac    gug uuuauggcuuuu auuccuauguga a u a
    |||   |||||    ||| |||||||||||| |||||||||||| | | u
3'  cua   aagug    cau aaguaccgaagg uagggauguacu u a a
   a   -aa     -uua   a            -            c g a 
Get sequence
Deep sequencing
13203 reads, 44.4 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 97414776-97414875 [+]
intergenic
Database links

Mature sequence mml-miR-135a-5p

Accession MIMAT0002251
Previous IDsmml-miR-135
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Deep sequencing23863 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-135a-2-3p

Accession MIMAT0026567
Sequence

61 - 

auguagggauggaagccaugaa

 - 82

Get sequence
Deep sequencing1272 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).