Stem-loop sequence mml-mir-130a

AccessionMI0002524 (change log)
DescriptionMacaca mulatta miR-130a stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   ugcugcu      a        c      ug  a   ucu  a 
5'        ggccag gcucuuuu acauug  cu cug   gc c
          |||||| |||||||| ||||||  || |||   ||  
3'        ccgguu cgggaaaa uguaac  ga gau   ug c
   -------      a        u      gu  c   cac  u 
Get sequence
Deep sequencing
54703 reads, 300 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 15997927-15998007 [-]
antisense
ENSMMUT00000044193 ; SSRP1-201; intron 1
ENSMMUT00000044190 ; SSRP1-202; 3'UTR (exon 2)
Database links

Mature sequence mml-miR-130a-5p

Accession MIMAT0026566
Sequence

15 - 

gcucuuuucacauugugcuacu

 - 36

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-130a-3p

Accession MIMAT0002235
Sequence

55 - 

cagugcaauguuaaaagggc

 - 74

Get sequence
Deep sequencing54677 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).