Stem-loop sequence mml-mir-128a

AccessionMI0002518 (change log)
Previous IDsmml-mir-128a;mml-mir-128
DescriptionMacaca mulatta miR-128a stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u    u      uuc       uag      cu       u 
5'  gagc guugga   ggggccg   cacugu  gagaggu u
    |||| ||||||   |||||||   ||||||  |||||||  
3'  uucg cgacuu   cucuggc   gugaca  cucuuua a
   c    u      uuu       caa      --       c 
Get sequence
Deep sequencing
124273 reads, 544 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr12: 21159071-21159152 [+]
antisense
ENSMMUT00000025826 ; DARS-201; intron 4
Database links

Mature sequence mml-miR-128a-5p

Accession MIMAT0026565
Sequence

15 - 

cggggccguagcacugucugaga

 - 37

Get sequence
Deep sequencing803 reads, 9 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence mml-miR-128a-3p

Accession MIMAT0002229
Previous IDsmml-miR-128a;mml-miR-128
Sequence

50 - 

ucacagugaaccggucucuuuu

 - 71

Get sequence
Deep sequencing123470 reads, 9 experiments
Evidence experimental; cloned [1], Illumina [3]
Database links
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).