Stem-loop sequence mml-mir-125b-1

AccessionMI0002514 (change log)
DescriptionMacaca mulatta miR-125b-1 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention mml-mir-125b-1
(35 sentences)

Stem-loop
   u    uc   u   uc  ug   c           au     c 
5'  gcgc  cuc cag  cc  aga ccuaacuugug  guuua c
    ||||  ||| |||  ||  ||| |||||||||||  ||||| g
3'  cgug  gag guc  gg  ucu ggauugggcac  uaaau u
   u    cu   c   ga  gu   c           -c     u 
Get sequence
Deep sequencing
803135 reads, 4.21e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 114954035-114954122 [-]
sense
ENSMMUT00000043622 ; HEPACAM-201; exon 4
ENSMMUT00000030366 ; HEPACAM-202; intron 4
Database links

Mature sequence mml-miR-125b-5p

Accession MIMAT0002225
Sequence

15 - 

ucccugagacccuaacuuguga

 - 36

Get sequence
Deep sequencing1595690 reads, 9 experiments
Evidence experimental; cloned [1], Illumina [3]
Database links
Predicted targets

Mature sequence mml-miR-125b-1-3p

Accession MIMAT0026564
Sequence

55 - 

acggguuaggcucuugggagcu

 - 76

Get sequence
Deep sequencing5311 reads, 9 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).