Stem-loop sequence mml-mir-30b

AccessionMI0002502 (change log)
DescriptionMacaca mulatta miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention mml-mir-30b
(19 sentences)

Stem-loop
   a     uu      cau          u  -a        uaaua 
5'  ccaag  ucaguu   guaaacaucc ac  cucagcug     c
    |||||  ||||||   |||||||||| ||  ||||||||      
3'  gguuc  agucga   cauuuguagg ug  gggucggu     a
   a     --      cuu          -  ga        uaggu 
Get sequence
Deep sequencing
33583 reads, 200 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 134094376-134094463 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-30b
mml-mir-30dchr8: 134099791-134099859 [-]
mml-mir-30bchr8: 134094376-134094463 [-]
Database links

Mature sequence mml-miR-30b-5p

Accession MIMAT0002213
Sequence

17 - 

uguaaacauccuacacucagc

 - 37

Get sequence
Deep sequencing33197 reads, 9 experiments
Evidence experimental; cloned [1], Illumina [3]
Database links
Predicted targets

Mature sequence mml-miR-30b-3p

Accession MIMAT0026563
Sequence

55 - 

cugggagguggauguuuacuuc

 - 76

Get sequence
Deep sequencing338 reads, 9 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).