Stem-loop sequence mml-mir-15b

AccessionMI0002496 (change log)
DescriptionMacaca mulatta miR-15b stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention mml-mir-15b
(2 sentences)

Stem-loop
   u    --g       gua   u       c  c      ua   a  ac 
5'  ugag   ccuuaaa   cug agcagca au augguu  cau cu  a
    ||||   |||||||   ||| ||||||| || ||||||  ||| ||  g
3'  acuu   ggaauuu   gau ucgucgu ua uacuaa  gua ga  u
   u    aaa       aaa   c       u  u      gc   -  ac 
Get sequence
Deep sequencing
6182 reads, 33.3 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 134308684-134308781 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-15b
mml-mir-15bchr2: 134308684-134308781 [-]
mml-mir-16-2chr2: 134308544-134308624 [-]
Database links

Mature sequence mml-miR-15b-5p

Accession MIMAT0002207
Sequence

20 - 

uagcagcacaucaugguuuaca

 - 41

Get sequence
Deep sequencing5930 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-15b-3p

Accession MIMAT0026562
Sequence

58 - 

cgaaucauuauuugcugcucua

 - 79

Get sequence
Deep sequencing240 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).