Stem-loop sequence ppy-mir-15b

AccessionMI0002494 (change log)
DescriptionPongo pygmaeus miR-15b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   u    --g       gua   u       c  c      ua   g  ac 
5'  ugag   ccuuaaa   cug agcagca au augguu  cau cu  a
    ||||   |||||||   ||| ||||||| || ||||||  ||| ||  g
3'  acuu   ggaauuu   gau ucgucgu ua uacuaa  gua ga  u
   u    aaa       aaa   c       u  u      gc   -  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr3: 163674098-163674195 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-15b
ppy-mir-15bchr3: 163674098-163674195 [+]
ppy-mir-16-2chr3: 163674255-163674336 [+]
Database links

Mature sequence ppy-miR-15b

Accession MIMAT0002205
Sequence

20 - 

uagcagcacaucaugguuuaca

 - 41

Get sequence
Evidence by similarity; MI0000438

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).